가족력이 있는 열성경련에서 SCN1A 유전자의 돌연변이

• 영문명: Mutations of SCN1A in Familial Febrile Seizures
• 발행기관: 대한소아신경학회
• 저자명: 강주미(Joo-Mee Kang) 노석만(Suk-Man Roh) 김영훈(Young-Hoon Kim) 정승연(Seung-Yun Chung) 이인구(In-Goo Lee) 황경태(Kyung-Tai Whang)
• 간행물 정보: 『Annals of Child Neurology(구 대한소아신경학회지)』대한소아신경학회지 제11권 제1호, 47~54쪽, 전체 8쪽
• 주제분류: 의약학 > 의학일반
• 파일형태: PDF
• 발행일자: 2003.05.30

국문 초록

목 적 ; 열성경련은 6세 이하 소아의 2-5%에서 경험하는 비교적 흔한 질환이다. 열성경련을 경험한 소아의 일부는 나중에 비열성 경련성질환과 간질로 발전한다. 전압관문 나트륨채널 아형(Voltage-gated sodium channel subunit) 유전자인 SCN1A의 돌연변이는 열성경련플러스(GEFS+)를 보이는 상염색체우성 전신간질과 중증 근간대성 간질을 보이는 영아의 열성경련과 관련이 있는 것으로 알려지고 있다. 저자들은 가족력이 있는 전형적인 열성경련아를 대상으로 SCN1B유전자의 돌연변이 여부를 알아보기 위하여 본 연구를 시행하였다. 방 법 : 가톨릭대학교 의정부성모병원 및 성모자애병원 소아과에서 가족력이 있는 열성경련으로 진단받은 환아 48명을 대상으로 하였다. 알려지지 않은 돌연변이를 밝히기 위하여 SCN1A 유전자 exon 9을 포함한 부분은 primer쌍(Foward GGAGGGTGAGACGCTGACTC, Reverse CACCTGGAGCTCCCCAGCTG)을 가지고 touchdown PCR방법을 수행하였으며 알려진 돌연변이를 발견하기 위하여 SCN1A유전자의 exon이 포함된 부분은 적절한 primer쌍을 이용하여 PCR을 시행하였다. 10개의 보고된 SCN1A 의 돌연변이는 SNaPshot 방법으로 수행하였다. 이상소견을 보인 DNA 조각은 염기서열 분석을 하였다. 결 과 : 대상 총 48명 중 단순 열성경련아는 30명(62.5%), 복함 열성경련아는 18명(37.5%)이었다. 연령 분포를 보면 12개월 미만 3명(6.3%), 12개월에서 36개월 미만 29명(60.4%), 36개월 이상 16명(33.3%)이었다. 남녀비는 0.66였다. 환아의 간질발작 양상으로는 전신 강직-간대발작 45명(93.8%), 근간대발작 1명(2.1%), 탈력발작 2명(4.2%)이었다. 뇌파소견은 정상 38명(79.2%)이었으며 약간의 비특이적인 이상을 보인 환아가 10명(20.9%)이었다. SNaPshot 방법과 염기서열분석을 통한 본 연구에서는 열성경련아 모두에서 SCN1B 유전자 돌연변이를 관찰할 수 없었다. 결 론 : 이러한 결과는 SCN1A가 흔한 열성경련에 관여하는 것은 흔하지 않다는 것을 보여주는 것으로 특별한 열성경련 유전자와 관련이 있음을 시사한다.

영문 초록

Purpose : Febrile seizures affect 2-5% of all children younger than 6 years old. A small proportion of children with febrile seizures later develop epilepsy. Muations in the voltage-gated sodium channel subunit gene SCN1A have been associated with febrile seizures(FSs) in autosomal dominant generalized epilepsy with febrile seizures plus(GEFS+) families and severe myoclonic epilepsy of infancy. The present study assessed the role of SCN1A in familial typical FSs. Methods : Forty-eight familial FSs were selected throughout a collaborative study of Catholic Child Neurology Research Group. To identify unknown mutations, regions containing the exons for SCN1A gene was performed with two primer(Foward GGAGGGTGAGACGCTGACTC, Reverse CACCTGGAGCTCCCCAGCTG) by touchdown PCR method, and to identify known mutations, regions containing exons of the SCN1A gene were amplified by PCR using suitable primer sets. Ten reported mutations of SCN1A were screened by SNaPshot method. DNA fragments showing variant chromatograms were subsequently sequenced. Results : Among 48 FS patients, thirty(62.5%) showed simple FSs, and eighteen(37.5%) had complex FS+. Three patients(6.3%) were younger than 12 months old, twentynine(60.4%) between 12 and 36 months old, and sixteen(33.3%) older than 36 months old. The ratio of female to male was 0.66:1.0. In the phenotypes of FSs, forty-five patients(93.8%) had generalized tonic-clonic seizures, one patient(2.1%) myoclonic seizures and two patients(4.2%) atonic seizures. In EEG findings of FSs, thirty-eight(79.2%) patients had normal findings, and ten(20.9%) patients had mild aspecific abnormalities. Mutational analysis detected no mutations of SCN1A. Conclusion : Our study demonstrated that SCN1A is not frequently involved in common FSs and suggested any involvement of specific FS genes.

키워드

Familial febrile seizure SCN1A Mutation